RT @theNCI: What is vitamin D and can it help reduce the risk of cancer in people? http://t.co/7Fg2ofeHLj #research
4:50pm November 21st 2013 via Hootsuite
The Weekend Interview With Dr. Francis Collins: Politics on the Frontier of Science - WSJ http://t.co/5ktGeEQir5
3:50pm November 21st 2013 via Hootsuite
C Bustamonte: "Any considering a career in genomics... it's an incredibly transformative science" #GreatChallenges http://t.co/VBcYRCViDC
3:20pm November 21st 2013 via Hootsuite
Sharon Terry: "The question is how to get people to 'own' their health. And #genomics might be a great place to start" #GreatChallenges
2:58pm November 21st 2013 via Hootsuite
James Evans: "0.5 - 1.0% of individuals have a genetic predisposition to a preventable disease". #GreatChallenges
2:55pm November 21st 2013 via Hootsuite
James Evans: "Over 1M visitors to the Smithsonian genomics exhibit". #GreatChallenges http://t.co/hSwP0l9Zln
2:48pm November 21st 2013 via Hootsuite
RT @NatureMagazine: Sequencing of ancient Siberian genomes adds to our understanding of ancestry of Native Americans http://t.co/NmjJFrt3hq
1:50pm November 21st 2013 via Hootsuite
Take The Quiz: What Kind of Productive Person Are You? | Fast Company http://t.co/8UvEBI2aKF
12:50pm November 21st 2013 via Hootsuite
RT @NIHDirector: Big news for #personalizedmedicine: FDA clears 1st genome sequencer. #NIH research helped pave way! http://t.co/GKPzhCUkiJ
11:51am November 21st 2013 via Hootsuite
TIL that Snyder's Personal Omics Project had about 50TB of data for the first 14 timepoints (out of 61), and 6TB for 'every sample'.
10:51am November 21st 2013 via Hootsuite
TIL that Snyder's genome had no less than 51 rare variants in disease-related genes. 9 non-sense mutations. PubMed http://t.co/jxfYlmS26h
9:50am November 21st 2013 via Hootsuite
TIL that Michael Snyder's Personal Omics Project took 40 mo, 61 timepoints, and 6 viral infections. PubMed http://t.co/jxfYlmS26h
8:50am November 21st 2013 via Hootsuite
CS Education Week "Hour of Code" Dec 9 2013 RT @slashdot: Zuckerberg To Teach 10 Million Kids 0-Based Counting http://t.co/piiJYwejFZ
7:50am November 21st 2013 via Hootsuite
RT @sciencemagazine: A new scheme can detect a single photon again and again w/o destroying it http://t.co/PyCV3B3awR http://t.co/CTXruFVAe6
6:50am November 21st 2013 via Hootsuite
RT @mental_floss: There's $1.2 trillion of paper money in circulation, but only 15% is accounted for. http://t.co/0HtAb5yCOk
5:50am November 21st 2013 via Hootsuite
Interesting list to watch RT @RfwrightLSL: Will #life #science #crowdfunding work? | Life Sci Leader http://t.co/VXZnNnLBY2
4:20am November 21st 2013 via Hootsuite
'The Hobbit may well prove a classic' RT @brainpicker: C. S. Lewis reviews The Hobbit, 1937 http://t.co/fyqCFRjlMg
9:40pm November 20th 2013 via Hootsuite
RT @InSequence: In Update on Next-Gen Sequencing Strategy, Qiagen Continues to Stress Workflow Advantages, Content http://t.co/uEUoeNfSMP
8:40pm November 20th 2013 via Hootsuite
RT @carlzimmer: The @nytimes obit for Fred Sanger: http://t.co/cFuHkPtGAC Ten years just to sequence the insulin protein!
7:40pm November 20th 2013 via Hootsuite
@lalocalindsay Advice for your new (bioinformatics) career | Nature Biotech http://t.co/OomHEISmoO
6:40pm November 20th 2013 via Hootsuite
RT @iontorrent: Nikiforova: fusion gene detection performed using 5-10ng of RNA from FNA & FFPE, 8-10 samples per 318 chip = LOD 1% #AMP
5:40pm November 20th 2013 via Hootsuite
RT @iontorrent: Is This New Machine the Key to Curing #Cancer? via @BloombergTV http://t.co/AEKU15DnQX
4:40pm November 20th 2013 via Hootsuite
RT @MayoClinicCIM: You Can't Predict Destiny by Designing Your Baby's #Genome. | WSJ http://t.co/oNrCbkehIg
3:41pm November 20th 2013 via Hootsuite
Worth a look RT @MakingTheNumber: Questions Top Sales Reps Ask in a Job Interview http://t.co/Rae7EDqPAS #B2bSales
2:40pm November 20th 2013 via Hootsuite
RT @InSequence: Paired Ends: Lawrence Brody, George Weinstock http://t.co/A2Gl1CYWcf
1:40pm November 20th 2013 via Hootsuite
The scary Internet of things | Wash Post http://t.co/bPhR0mDFnh
12:40pm November 20th 2013 via Hootsuite
RT @gilbertjacka: NEW CAPTION CONTEST - http://t.co/MF0kPXfPfv - Roche donate $20 to the Earth Microbiome Project for every caption made!!
11:41am November 20th 2013 via Hootsuite
Hint: http://t.co/wHNyJ3KDAi RT @mbeisen: AGAAUCCCC UCCAUUAGG UUUAGGGAGGAUGAAAGAAUUUGCAAA UCCGCAAACGGCGAAAGA #FredSanger
11:03am November 20th 2013 via Hootsuite
RT @cdfrith: All you need to know about cognitive neuroscience in 4 panels http://t.co/x1nEHuC6eN
10:40am November 20th 2013 via Hootsuite
DriverDB: an exome sequencing database for cancer driver gene identification Nucl Acids Res - PubMed http://t.co/hMmKbOiHlw
9:40am November 20th 2013 via Hootsuite
FDA OK's four Illumina next-generation sequencing devices - FierceDiagnostics http://t.co/lcGAaQ0Fk7
9:11am November 20th 2013 via Hootsuite
RT @JohnMulley: Sad reflection on society a great UK scientist's death with 2 Nobel prizes has no chance of trending on Twitter. #Sanger
8:50am November 20th 2013 via Hootsuite
RT @ewencallaway: When we started... I don’t believe we were thinking about the entire human genome -Fred Sanger http://t.co/CHmFAkCNCB
8:46am November 20th 2013 via Hootsuite
RT @MRCcomms: Sad news: Fred Sanger, double Nobel Prize winner for amino acid & DNA sequencing, has died. @MRC_LMB http://t.co/j20GvOxlU
8:40am November 20th 2013 via Hootsuite
RT @AMAnet: 5 Simple Steps To Never Feeling Overwhelmed Again. (via @PickTheBrain) #WorkLife #Career | http://t.co/DdXyG7KYDu
7:40am November 20th 2013 via Hootsuite
RT @sapinker: Doug Hofstadter vs. the mindlessness of today's Artificial Intelligence - The Atlantic http://t.co/cugYCC7lFb
6:40am November 20th 2013 via Hootsuite
RT @mims: Americans are leaving more than half a billion vacation days on the table http://t.co/HBa3tjgfwo
5:40am November 20th 2013 via Hootsuite
Kingsmore's group RT @AllSeq: World’s Fastest Genome Analysis Technology Helps Critical-Condition Newborns http://t.co/1S30dAtN3A
4:40am November 20th 2013 via Hootsuite
RT @dnnyboy: Aren't you glad we have computers? Manual #DNA #sequence #assembly http://t.co/A1xoP8c1R0
9:35pm November 19th 2013 via Hootsuite
RT @TEDMED: Join Eric Green of @genome_gov, others to describe capabilities of #genome research. http://t.co/CeymoH9Q17 #GreatChallenges
8:35pm November 19th 2013 via Hootsuite
RT @DailyNewsGW: ACMG Lands $12.5M for Newborn Screening Research Resource Center http://t.co/aZex1Ael2Z
7:35pm November 19th 2013 via Hootsuite
RT @washingtonpost: Bad news: Oxford Dictionaries crowns "selfie" word of the year. Good news: "Selfie" beat "twerk". http://t.co/PkZe6G2Bvk
6:35pm November 19th 2013 via Hootsuite
IDC Report: The Future of eMail is Social - TechRepublic http://t.co/ebAJvq4uMp
5:35pm November 19th 2013 via Hootsuite
Scanadu Closes $10.5M Series A Round, Gearing Up To Send Its Medical Tricorder Through Clinical Testing | TechCrunch http://t.co/S4lWRj0D5v
4:35pm November 19th 2013 via Hootsuite
RT @Diane_McKenna_: Ethical, legal and social impact of #genomics in US healthcare http://t.co/ru1LV2gBDD
3:35pm November 19th 2013 via Hootsuite
RT @TheAtlantic: The Gettysburg Address as a terrible Powerpoint presentation http://t.co/3zqLKHdpY2 http://t.co/dGY4BrRpiS
2:36pm November 19th 2013 via Hootsuite
RT @MyBioTechniques: Watch Elizabeth Blackburn describe the Discovery of Telomeric DNA and Telomerase http://t.co/42cUjxVfjJ
1:35pm November 19th 2013 via Hootsuite
RT @NIH: Research Matters: Genetic Enhancers Fine Tune Each Face http://t.co/CzOBMV1oOM
12:35pm November 19th 2013 via Hootsuite
RT @mashable: One's a disgraced Toronto mayor. The other an aging action star. Together they join forces. http://t.co/hPsB6jFlH5
11:35am November 19th 2013 via Hootsuite
RT @hanelly: “I saw the greatest minds of my generation destroyed by staring at smart phones." http://t.co/579R19jYSl
10:35am November 19th 2013 via Hootsuite
